Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | ||
|---|---|---|---|---|---|---|
| Plasmid | 44552 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 | Add to Cart | |
This material is available to academics and nonprofits only.
Backbone
- Vector backbonepRS403(Search Vector Database)
- Backbone manufacturerStratagene
- Backbone sizew/o insert(bp)4456
- Total vector size (bp)5941
- Modifications to backboneCYC1 transcriptional terminator present downstream of inserts (between XhoI and PvuII sites).Small region of additional homology to the his3 locus inserted in front of the HIS3 gene (between AhdI and AfeI sites) to facilitate integration.
- Vector typeYeast Expression, Synthetic Biology ; Expression regulator/reporter
- Selectable markersZeocin, HIS3
Growth in Bacteria
- Bacterial Resistance(s)Ampicillin
- Growth Temperature37°C
- Growth Strain(s)XL10 Gold
- Copy numberHigh Copy
Gene/Insert1
- Gene/Insert namePTETREG promoter
- Alt nameYeast ADH1 transcriptional term. and two copies of the tetO2 operator site upstream of the PCYC1 TATA box and minimal promoter
- Alt namertTA-MF inducible promoter
- SpeciesSynthetic
- Insert Size (bp)504
- PromoterPTETREG
Cloning Informationfor Gene/Insert 1
- Cloning methodRestriction Enzyme
- 5′ cloning siteAflII(not destroyed)
- 3′ cloning siteBamHI(not destroyed)
- 5′ sequencing primerF1ori-R (AGGGAAGAAAGCGAAAGGAG)
- 3′ sequencing primerGFP-R (Common Sequencing Primers)
Gene/Insert2
- Gene/Insert nameyEGFP::ZeoR
- Alt nameyeast-enhanced green fluorescent protein
- Alt nameBleomycin/Zeocin resistance protein
- SpeciesS. cerevisiae (budding yeast), Synthetic
- Insert Size (bp)1111
Cloning Informationfor Gene/Insert 2
- Cloning methodRestriction Enzyme
- 5′ cloning siteBamHI(not destroyed)
- 3′ cloning siteXhoI(not destroyed)
- 5′ sequencing primerUnknown
- 3′ sequencing primerZeo-R (ctgatgaacagggtcacgtc) (Common Sequencing Primers)
Resource Information
- Supplemental Documents
- pDN-T2dGZmxh.PDW
- A portion of this plasmid was derived from a plasmid made byPTETREG promoter from plasmid pBB247 from Attila Becskei and Luis Serrano, EMBL Heidelberg, Germany
- Terms and Licenses
- UBMTA
- Ancillary Agreement for Plasmids Containing FP Materials
- Industry Terms
- Not Available to Industry
Depositor Comments
This plasmids was created as follows. First, the PTETREG promoter consisting of two tetO2 sites upstream of the minimal PCYC1 promoter was amplified from the pBB247 plasmid (Becskei, Séraphin, and Serrano, EMBO 2001, PMID: 11350942), and inserted into the pDN-G1GZmh plasmid between the AflII and BamHI sites instead of the PGAL1-D12 promoter resulting in the pDN-T2dGZmh plasmid. In order to facilitate the planned integration of the reporter plasmid into the his3Δ200 locus of the YPH500 strain, a small region bearing homology to the his3Δ200 locus was constructed by PCR and inserted in front of the HIS3 gene between the AhdI and AfeI sites of the pDN-T2dGZmh plasmid, resulting in the pDN-T2dGZmlh plasmid. Next, a second ADH1 terminator was removed from the pDN-T2dGZmlh plasmid, resulting in the final reporter pDN-T2dGZmxh plasmid bearing the yEGFP::zeoR fluorescent reporter gene under the control of the PTETREG rtTA-MF inducible promoter.
